circadian rhythm comes up often in conversation and rarely with the context attached. Here we lay out the basics in order, then work through the practical considerations.
Updated 2025-09-28. Numbers and descriptions here follow the published literature rather than marketing material.
Several misconceptions surround SR9009. It is often described as a SARM, a steroid, or an exercise pill, but its known target is the REV-ERB receptor family. Rodent studies have examined exercise capacity and metabolic markers, yet human outcomes remain unproven. Oral bioavailability appears low in animals, and human pharmacokinetics are not well characterized. Online products may contain impurities or different compounds, so identity and purity testing are important for research use.
Analytical chemists detect SR9009 with liquid chromatography-tandem mass spectrometry, commonly abbreviated LC-MS/MS. Sample preparation may involve protein precipitation, liquid-liquid extraction, or solid-phase extraction before analysis. Laboratories can target the parent compound or its metabolites, depending on the matrix and the purpose of testing. Anti-doping methods require sensitive and specific assays because concentrations in biological samples can be low. Reference standards and validated methods are essential for reliable identification and quantification.
Mechanistically, SR9009 binds the ligand-binding domain of REV-ERBα/β and enhances recruitment of corepressor complexes. This represses target genes rather than activating them. Because REV-ERB proteins normally compete with ROR proteins at shared response elements, the net effect depends on tissue and timing. Researchers use SR9009 to probe how nuclear receptor signaling links the clock to metabolism, inflammation, and muscle biology. Findings are largely preclinical, and the precise contribution of each receptor subtype remains under study.
SR9009 is frequently discussed in fitness and research-chemical contexts, yet it has no approved medical indication. Regulatory agencies have not authorized it for human use, and it is not a standard prescription drug. Some sports organizations list it as a prohibited substance because of its potential performance-enhancing properties. Published human data are sparse, so claims about its effects in people often rely on animal models or anecdotal reports. Quality and identity of online materials can vary widely.
| Property | Value | Notes |
|---|---|---|
| Regulatory status | Not approved for human use | Research-use-only status in many markets |
| WADA status | Prohibited in sport | Generally listed as a non-approved substance |
| Detection technique | LC-MS/MS | Common for urine and blood analysis |
| Common alias | Stenabolic | Informal market nickname, not a pharmacopoeial name |
| Purity check | HPLC or LC-UV | Independent certificate of analysis is typical |
Regulatory status varies by country and intended use. Major drug agencies have not granted marketing authorization for SR9009 as a medicine, and it is not listed as a controlled substance in many jurisdictions. It is often sold as a research chemical, a category that may fall outside pharmaceutical manufacturing rules. Buyers should verify local laws and supplier documentation, including certificates of analysis. The lack of standardized quality controls raises concerns about identity, purity, and actual content in products marketed online.
In laboratory settings, SR9009 is commonly identified by its molecular structure and its interaction with REV-ERB receptors. Vendors may list it under synonyms such as Stenabolic or REV-ERB agonist, but those names do not define purity or identity. Analytical confirmation typically uses high-performance liquid chromatography with ultraviolet detection or liquid chromatography–mass spectrometry. A reference standard is needed to compare retention time and mass spectrum, because the compound can be confused with related research chemicals.
REV-ERB proteins typically suppress gene expression by recruiting corepressor complexes to DNA response elements. SR9009 binds these receptors and strengthens that repressive action in cell-based assays. Studies in rodents have reported changes in lipid handling, mitochondrial function, and exercise capacity after treatment. Such findings are often cited as evidence for metabolic effects, but species differences and limited pharmacokinetic data make direct translation to humans uncertain. Researchers continue to examine which effects are robust and which depend on specific experimental conditions.
SR9009 is frequently discussed alongside other REV-ERB ligands, including synthetic agonists and natural heme-related molecules. Its selectivity for REV-ERB over related nuclear receptors has been measured in binding and reporter assays, though off-target activity at higher concentrations is possible. The compound is prohibited in sport by the World Anti-Doping Agency, and it is not approved for any medical use in major jurisdictions. Products sold online may be labeled as research chemicals, and their identity and purity are not guaranteed by regulatory review.
SR9009 is a synthetic small molecule studied as an agonist of REV-ERB nuclear receptors. REV-ERB alpha and REV-ERB beta help regulate circadian rhythms and metabolic gene expression. In laboratory research, SR9009 has been used to probe how these receptors affect skeletal muscle, liver, and adipose tissue. The compound was identified in academic drug-discovery work and is often described in scientific literature by its chemical name and research code. It is not an approved medicine, and human clinical data remain limited or absent.
SR9009 binds REV-ERB receptors and alters their repressive activity on target genes. This action can change transcription of genes involved in lipid handling, glucose metabolism, and mitochondrial function. In rodent studies, treated animals have shown changes in muscle oxidative capacity and exercise performance, though effects vary by dose, duration, and model. The precise molecular steps connecting receptor binding to whole-body outcomes are still an active area of investigation. Findings in animals do not automatically translate to humans.
Analytical identification of SR9009 typically relies on liquid chromatography coupled with tandem mass spectrometry. In biological samples, researchers first separate the compound from matrix components using protein precipitation, liquid-liquid extraction, or solid-phase extraction. High-performance liquid chromatography with ultraviolet detection and nuclear magnetic resonance spectroscopy can support structural confirmation of reference materials. Because SR9009 is a small, relatively lipophilic molecule, reverse-phase columns and acidic mobile phases are common. Laboratories often include isotope-labeled internal standards to improve quantification and to correct for ion suppression.
Stability depends on physical form, temperature, light exposure, and solvent. Solid SR9009 is generally stored cold and dry, with protection from light to limit degradation. Dimethyl sulfoxide stocks are common for laboratory work, but repeated freeze-thaw cycles can reduce compound integrity. Aqueous solutions may be less stable than organic stocks, and the ethyl ester in the structure can be susceptible to hydrolysis under certain conditions. Researchers typically validate storage conditions and recheck purity before quantitative experiments, especially when using archived material.
Regulatory treatment of SR9009 varies by country and region. It is not approved as a pharmaceutical, and several jurisdictions restrict its sale for human consumption. Some authorities classify it as a research chemical, a prescription-only substance, or a prohibited performance-enhancing agent in sport. Purchasers may encounter certificates of analysis, but these documents do not guarantee identity, purity, or legality. In research settings, institutional safety reviews and controlled procurement help ensure that materials are handled under appropriate oversight. The absence of harmonized rules means that legal status can change and requires verification.
== Production == Dogtooth was the feature film debut for Boo Productions, an Athens-based advertising company. The Greek Film Center supported the project with about €200,000, and much of the production was done with help from volunteers. Another €50,000 was offered by the production studio. The script was completed in about 2 years, with rehearsals lasting 1+1⁄2 months. The film was shot in about 1 month (in August 2008), and editing took 6 months. Anna Kalaitzidou and Christos Passalis were stage actors who were cast after having worked with Lanthimos earlier. Mary Tsoni was not a professional actress; she was a singer in a punk band. Lanthimos had an open approach to both acting and visual style and felt it would look fake if he involved himself too much in the details. Only when rehearsals started did he begin to develop an idea of the style in which the film should be shot: one where he tried to combine a realistic environment with "really strict framing and a cool, surreal look to go with the narrative".
=== Optoelectronics === Graphene strongly interacts with photons, with the potential for direct band-gap creation. This is promising for optoelectronic and nanophotonic devices. Light interaction arises due to the Van Hove singularity. Graphene displays different time scales in response to photon interaction, ranging from femtoseconds (ultra-fast) to picoseconds. Potential uses include transparent films, touch screens and light emitters or as a plasmonic device that confines light and alters wavelengths.
==== DNA replication ==== DNA replication has been shown to affect the function of various DNA repair enzymes. H-DNA formation involves the formation of single-stranded DNA (ssDNA), which is more susceptible to attack by nucleases. Various nucleases have been shown to interact with H-DNA in a replication-dependent or replication-independent manner. A study using human cells found that the nucleotide excision repair (NER) nucleases ERCC1-XPF and ERCC1-XPG induced genetic instability. These enzymes cleave H-DNA at the loop formed by the two Hoogsteen hydrogen-bonded strands and the 5' end of the other Watson-Crick hydrogen-bonded strand, respectively. This cleavage has been shown to induce large deletions that cause double strand breaks (DSBs) in DNA that can lead to genetic instability. In cells deficient in ERCC1-XPF and ERCC1-XPG, these deletions were less prevalent near H-DNA forming sequences. Additionally, more mutations were found in ERCC1-XPF and ERCC1-XPG deficient cells in the absence of DNA replication, which suggests they process H-DNA in a replication-independent manner. Alternatively, the DNA-replication repair nuclease FEN1 was found to suppress genetic instability. Similar to ERCC1-XPG, FEN1 cleaves H-DNA at the 5' end of the strand not involved in Hoogsteen hydrogen-bonding. HeLa cells deficient in FEN1 showed higher prevalence of deletions near H-DNA forming sequences, but H-DNA induced mutagenesis was more pronounced in FEN1 deficient cells in the presence of DNA replication.
Dipicolinic acid (pyridine-2,6-dicarboxylic acid or PDC and DPA) is a chemical compound which plays a role in the heat resistance of bacterial endospores. It is also used to prepare dipicolinato ligated lanthanide and transition metal complexes for ion chromatography.
Sources: en.wikipedia.org
=== 1994–1999: The Double Trio, Vrooom, Thrak and the ProjeKcts === In the summer of 1991, Belew met with Fripp in England to express an interest in reviving King Crimson. That year saw the release of the retrospective box set Frame by Frame: The Essential King Crimson. A follow-up box set, The Great Deceiver, appeared the following year as the first release on Fripp's newly-established record label Discipline Global Mobile (DGM), formed with producer David Singleton. Subsequently, DGM would be the primary home for Fripp's work, with larger album releases distributed to bigger record companies (initially Virgin Records), and smaller releases handled by DGM. This afforded Fripp and his associates greater creative freedom and more control over all aspects of their work.
After basic processing, teas may be altered through additional processing steps before being sold and is often consumed with additions to the basic tea leaf and water added during preparation or drinking. Examples of additional processing steps that occur before tea is sold are blending, flavouring, scenting, and decaffeination of teas. Examples of additions added at the point of consumption include milk, sugar and lemon. Tea blending is the combination of different teas together to achieve the final product. Such teas may combine others from the same cultivation area or several different ones. The aim is to obtain consistency, better taste, higher price, or some combination of the three. Flavoured and scented teas are enhancements of the base tea. This can be accomplished through directly adding flavouring agents, such as ginger, cloves, mint leaves, cardamom, bergamot (found in Earl Grey), vanilla, and spearmint. Alternatively, because tea easily retains odours, it can be placed in proximity to an aromatic ingredient to absorb its aroma, as in traditional jasmine tea.
Nuclear factor erythroid 2-related factor 2, also known as NFE2-Related Factor 2 (NRF2) or nuclear factor erythroid-derived 2-like 2 (NFE2L2), is a transcription factor that in humans is encoded by the NFE2L2 gene. NRF2 is a basic leucine zipper (bZIP) protein that may regulate the expression of antioxidant proteins that protect against oxidative damage triggered by injury and inflammation, according to preliminary research. In vitro, NRF2 binds to antioxidant response elements (AREs) in the promoter regions of genes encoding cytoprotective proteins. NRF2 induces the expression of heme oxygenase 1 in vitro leading to an increase in phase II enzymes. NRF2 also inhibits the NLRP3 inflammasome. NRF2 appears to participate in a complex regulatory network and performs a pleiotropic role in the regulation of metabolism, inflammation, autophagy, proteostasis, mitochondrial physiology, and immune responses. Several drugs that stimulate the NFE2L2 pathway are being studied for treatment of diseases that are caused by oxidative stress.
In pre-life, a 31 nucleotide D loop minihelix (GCGGCGGUAGCCUAGCCUAGCCUACCGCCGC) was ligated to two 31 nucleotide anticodon loop minihelices (GCGGCGGCCGGGCU/???AACCCGGCCGCCGC; / indicates a U-turn conformation in the RNA backbone; ? indicates unknown base identity) to form the 93 nucleotide tRNA precursor. To generate type II tRNAs, a single internal 9 nucleotide deletion occurred within ligated acceptor stems (CCGCCGCGCGGCGG goes to GGCGG). To generate type I tRNAs, an additional, related 9 nucleotide deletion occurred within ligated acceptor stems within the variable loop region (CCGCCGCGCGGCGG goes to CCGCC). These two 9 nucleotide deletions are identical on complementary RNA strands. tRNAomes (all of the tRNAs of an organism) were generated by duplication and mutation. Very clearly, life evolved from a polymer world that included RNA repeats and RNA inverted repeats (stem-loop-stems). Of particular importance were the 7 nucleotide U-turn loops (CU/???AA). After LUCA (the last universal common (cellular) ancestor), the T loop evolved to interact with the D loop at the tRNA "elbow" (T loop: UU/CAAAU, after LUCA). Polymer world progressed to minihelix world to tRNA world, which has endured for ~4 billion years. Analysis of tRNA sequences reveals a major successful pathway in evolution of life on Earth.
The eggs have large yolks; cleavage (division) is relatively shallow and a germinal disc develops at the pole. During gastrulation, the disc surrounds the yolk, forming a yolk sac, which eventually forms part of the gut. The embryo forms as the dorsal side of the disc grows upward, with a shell gland, gills, mantle and eyes on its dorsal side. The arms and funnel form on the ventral side of the disc, with the former moving upward to surround the mouth. The embryo consumes the yolk during development. Over a month after mating, giant Pacific octopuses lay eggs. The species can lay 180,000 eggs in a single clutch, while O. rubescens clutches host up to 45,000 eggs while O. vulgaris clutches can include 500,000 eggs. Fertilised octopus eggs are laid as strings within a shelter. Female giant Pacific octopuses nurture and protect their eggs for five months (160 days) until they hatch. In colder waters, such as those off Alaska, it may take up to ten months for the eggs to completely develop. In the argonaut (paper nautilus), the female is much larger than the male. She secretes a thin shell shaped like a cornucopia, in which the eggs are deposited and in which she also resides and broods the young while swimming.
Sources: en.wikipedia.org
=== Procedure in Vietnam === Prior to 2013, shooting was the primary method of execution in Vietnam. The use of lethal injection method was approved by the government in 2010, adopted in 2011, and then started being used in 2013. Urges to adopt other methods than lethal injection to replace the shooting execution began earlier, in 2006, after concerns of the mental state of the firing squad members after executions. The drugs used consist of sodium thiopental (anesthetic), pancuronium bromide (paralytic), and potassium chloride (cardiotoxin). The production of these substances, however, is low in Vietnam. This led to drug shortages and to considering using other domestic poisons or the readoption of shootings. The first prisoner in Vietnam to be executed by lethal injection, on August 6, 2013, was 27-year-old Nguyen Anh Tuan, arrested for murder and robbery. Between 2013 and 2016, 429 prisoners were executed by this method in the country.
In 1975 Lagin released Seastones, a quadraphonic album of electronic music (composed between 1970–1974 and constituting a small part of the complete Seastones composition) on Round Records and then United Artists Records. A new, two CD album of Seastones was released on March 8, 2018. This album, not a re-issue, presents most but not all of the composition as originally composed but never released or heard before. For this release, Seastones was re-mixed and re-mastered in stereo. It includes most of the original 1970–1974 studio forms, those parts of Lagin's concurrent but unfinished composition L that are shared with Seastones, as well as some of the moment forms generated and incorporated into the composition from live performances that took place from 1973 to 1975. This two CD album contains 83 tracks (54 tracks on CD One and 29 tracks on CD Two) and altogether is 111 minutes long.
=== Transmission === Scabies is contagious and can be contracted through prolonged physical contact with an infested person. This includes sexual intercourse, although a majority of cases are acquired through other forms of skin-to-skin contact. Less commonly, scabies infestation can happen through the sharing of clothes, towels, and bedding, but this is not a major mode of transmission; individual mites can survive for only two to three days, at most, away from human skin at room temperature. As with lice, a latex condom is ineffective against scabies transmission during intercourse, because mites typically migrate from one individual to the next at sites other than the sex organs. Multiple transmission factors allow scabies to achieve very high prevalence rates in institutional outbreaks, including crowded living conditions with high host density, social interactions involving prolonged skin-to-skin contact, sharing of bedding and clothing, frequent manual handling, limited access to laundry services, and immunocompromised populations. Healthcare workers are at risk of contracting scabies from patients, because they may be in extended contact with them.
=== Industrial processes === Argon is used in some high-temperature industrial processes where ordinarily non-reactive substances become reactive. For example, an argon atmosphere is used in graphite electric furnaces to prevent the graphite from burning. For some of these processes, the presence of nitrogen or oxygen gases might cause defects within the material. Argon is used in some types of arc welding such as gas metal arc welding and gas tungsten arc welding, as well as in the processing of titanium and other reactive elements. An argon atmosphere is also used for growing crystals of silicon and germanium.
Sources: en.wikipedia.org
Legality depends on the country and the intended use. In many places it is not approved as a medicine and may be sold only as a research chemical. Importation or possession can be restricted, and sports organizations prohibit it.
Anti-doping laboratories typically use LC-MS/MS to detect SR9009 or its metabolites in urine or blood. The exact assay depends on the laboratory and the testing program. Detection can be challenging because the compound may be rapidly metabolized and present at low levels.
Stenabolic is an informal nickname used in online fitness and research-chemical markets, not an official drug name. It likely references reported effects on endurance in rodent studies. The nickname does not imply approval or proven human benefit.
SR9009 is a synthetic compound investigated as an agonist of the nuclear receptors REV-ERBα and REV-ERBβ. It is used in preclinical research on circadian rhythm and metabolism. It is not an approved drug.